pRegev_ExonSkip_LandingPad
(Plasmid
#204186)
-
PurposeBackbone for cloning individual exon sequences into beta globin minigene splicing reporter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRegev_ExonSkip_Backbone
-
Backbone manufacturerRegev Group (NYU)
- Total vector size (bp) 8587
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBeta globin splicing minigene
-
SpeciesSynthetic
-
Insert Size (bp)234
- Promoter Truncated CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMinigene design from Kristen Lynch (SA Smith and KW Lynch, "Cell-based splicing of minigenes." (2014)). Backbone design modified from Georg Seelig (AB Rosenberg et al, "Learning the sequence determinants of alternative splicing from millions of random sequences." (2015)).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRegev_ExonSkip_LandingPad was a gift from Oded Regev (Addgene plasmid # 204186 ; http://n2t.net/addgene:204186 ; RRID:Addgene_204186) -
For your References section:
Deciphering RNA splicing logic with interpretable machine learning. Liao SE, Sudarshan M, Regev O. Proc Natl Acad Sci U S A. 2023 Oct 10;120(41):e2221165120. doi: 10.1073/pnas.2221165120. Epub 2023 Oct 5. 10.1073/pnas.2221165120 PubMed 37796983