Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRegev_S1.46G>U
(Plasmid #204160)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204160 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRegev_ExonSkip_LandingPad
  • Backbone manufacturer
    Regev Group (NYU)
  • Total vector size (bp) 8612
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    S1 exon with 46G>U substitution in beta globin splicing minigene
  • Species
    Synthetic
  • Insert Size (bp)
    76
  • Mutation
    46G>U substitution
  • Promoter Truncated CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Minigene design from Kristen Lynch (SA Smith and KW Lynch, "Cell-based splicing of minigenes." (2014)). Backbone design modified from Georg Seelig (AB Rosenberg et al, "Learning the sequence determinants of alternative splicing from millions of random sequences." (2015)).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRegev_S1.46G>U was a gift from Oded Regev (Addgene plasmid # 204160 ; http://n2t.net/addgene:204160 ; RRID:Addgene_204160)
  • For your References section:

    Deciphering RNA splicing logic with interpretable machine learning. Liao SE, Sudarshan M, Regev O. Proc Natl Acad Sci U S A. 2023 Oct 10;120(41):e2221165120. doi: 10.1073/pnas.2221165120. Epub 2023 Oct 5. 10.1073/pnas.2221165120 PubMed 37796983