Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUCmini-NFKB1-PGK-tdTomato
(Plasmid #204019)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204019 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC-mini
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tdTomato
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer atggtgagcaagggcgaggaggtc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCmini-NFKB1-PGK-tdTomato was a gift from Yohei Sato (Addgene plasmid # 204019 ; http://n2t.net/addgene:204019 ; RRID:Addgene_204019)
  • For your References section:

    Non-canonical NFKB signaling endows suppressive function through FOXP3-dependent regulatory T cell program. Sato Y, Osada E, Manome Y. Heliyon. 2023 Nov 26;9(12):e22911. doi: 10.1016/j.heliyon.2023.e22911. eCollection 2023 Dec. 10.1016/j.heliyon.2023.e22911 PubMed 38125410