pWR95(URA3)
(Plasmid #203917)

• Purpose: BLINCAR plasmid for gene deletion, URA3 target
• Depositing Lab: J. Brian Robertson
• Publication: Reichard et al mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22.

Backbone

• Vector backbone: pWR95
• Backbone manufacturer: Robertson
• Backbone size w/o insert (bp): 8093
• Total vector size (bp): 12000
• Modifications to backbone: upstream and downstream homology regions for URA3 were added to pWR95
• Vector type: Yeast Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: URA3 upstream homology
• Species: S. stipitis (yeast)
• Insert Size (bp): 1986

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CACGGAAATGTTGAATACTC

Gene/Insert 2

• Gene/Insert name: URA3 downstream homology
• Species: S. stipitis (yeast)
• Insert Size (bp): 2038

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: TTCAGAAGGCAGAACTAGT
• 3′ sequencing primer: ACCTCTGACTTGAGCGTC

Resource Information

• Supplemental Documents:
  • WR95-URA3.gb
  • WR95-URA3.gb
• A portion of this plasmid was derived from a plasmid made by: coCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry