pWR95
(Plasmid #203916)

• Purpose: BLINCAR plasmid for gene deletion, no genomic target
• Depositing Lab: J. Brian Robertson
• Publication: Reichard et al mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22.

Backbone

• Vector backbone: pWR88
• Backbone manufacturer: Robertson
• Backbone size w/o insert (bp): 8072
• Total vector size (bp): 8093
• Modifications to backbone: pAllet was digested with EcoRV and SalI, blunted, and religated. Then the AgeI to XbaI portion of this modified MCS was moved to pWR88 using AgeI and XbaI.
• Vector type: Yeast Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: modified MCS
• Species: Synthetic; S. stipitis (yeast)
• Insert Size (bp): 85

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CACGGAAATGTTGAATACTC

Resource Information

• Supplemental Documents:
  • WR95.gb
  • WR95.gb
• A portion of this plasmid was derived from a plasmid made by: coCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry