pEF-1α_ZF9LOV[C1]-VP64 (pLZA125)
(Plasmid
#203910)
-
PurposeEncodes engineered opto-ZF9 with AsLOV2(408-543) inserted in C1 position in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203910 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepVITRO1-NEO-MCS
- Backbone size w/o insert (bp) 6994
- Total vector size (bp) 7897
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZF9LOV[C1]-VP64
-
SpeciesSynthetic
-
Insert Size (bp)903
- Promoter EF1α
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aaaccaccgctaattcaaagcaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-1α_ZF9LOV[C1]-VP64 (pLZA125) was a gift from Jared Toettcher (Addgene plasmid # 203910 ; http://n2t.net/addgene:203910 ; RRID:Addgene_203910) -
For your References section:
Light-switchable transcription factors obtained by direct screening in mammalian cells. Zhu L, McNamara HM, Toettcher JE. Nat Commun. 2023 Jun 2;14(1):3185. doi: 10.1038/s41467-023-38993-6. 10.1038/s41467-023-38993-6 PubMed 37268649
Map uploaded by the depositor.
