-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 20380 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMIR-REPORT
- Backbone size w/o insert (bp) 6470
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSIRT1
-
Alt namesirtuin (silent mating type information regulation 2 homolog) 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1420
-
Mutationmutant 3'UTR of SIRT1 (ACACCCACCAAGGACCATTAGTCCGAGA)
-
Entrez GeneSIRT1 (a.k.a. SIR2, SIR2L1, SIR2alpha)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer N/A (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are mismatches between Addgene's sequence and NCBI sequence for SIRT1 UTR. Deposit is aware of these changes and doesn't think they affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Luc-SIRT1 mutant 3'UTR was a gift from Charles Lowenstein (Addgene plasmid # 20380 ; http://n2t.net/addgene:20380 ; RRID:Addgene_20380) -
For your References section:
miR-34a repression of SIRT1 regulates apoptosis. Yamakuchi M, Ferlito M, Lowenstein CJ. Proc Natl Acad Sci U S A. 2008 Sep 9. 105(36):13421-6. 10.1073/pnas.0801613105 PubMed 18755897