Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p Pcrg1: Khd4-Ada-Gfp (CbxR)
(Plasmid #203734)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203734 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMF2-1c
  • Backbone size w/o insert (bp) 6763
  • Total vector size (bp) 12997
  • Vector type
    Bacterial Expression
  • Selectable markers
    Carboxin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Khd4-Ada-Gfp
  • Alt name
    Khd4-hyperTRIBE
  • Species
    D. melanogaster (fly); Ustilago maydis
  • Insert Size (bp)
    6234
  • GenBank ID
    XM_011391969.1 AHN59262.1
  • Promoter Pcrg1
  • Tag / Fusion Protein
    • Gfp (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sfi1 (not destroyed)
  • 3′ cloning site Asc1 (not destroyed)
  • 5′ sequencing primer GGCCTGATGGGCCATGGATTTCTACTCGACGTCCTTC
  • 3′ sequencing primer TCGCAAGACCGGCAACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p Pcrg1: Khd4-Ada-Gfp (CbxR) was a gift from Michael Feldbrügge (Addgene plasmid # 203734 ; http://n2t.net/addgene:203734 ; RRID:Addgene_203734)
  • For your References section:

    The mRNA stability factor Khd4 defines a specific mRNA regulon for membrane trafficking in the pathogen Ustilago maydis. Sankaranarayanan S, Haag C, Petzsch P, Kohrer K, Matuszynska A, Zarnack K, Feldbrugge M. Proc Natl Acad Sci U S A. 2023 Aug 22;120(34):e2301731120. doi: 10.1073/pnas.2301731120. Epub 2023 Aug 17. 10.1073/pnas.2301731120 PubMed 37590419