Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pESC-URA-GFP-Ubc9ts
(Plasmid #20369)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20369 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pESC-URA
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 6600
  • Vector type
    Yeast Expression ; yeast/bacteria shuttle
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SUMO-conjugating enzyme Ubc9
  • Alt name
    YDL064W
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    474
  • Mutation
    Y68L This mutation renders Ubc9 temperature-sensitive
  • Entrez Gene
    UBC9 (a.k.a. YDL064W)
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATTTTCGGTTTGTATTACTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pESC-URA-GFP-Ubc9ts was a gift from Judith Frydman (Addgene plasmid # 20369 ; http://n2t.net/addgene:20369 ; RRID:Addgene_20369)
  • For your References section:

    Misfolded proteins partition between two distinct quality control compartments. Kaganovich D, Kopito R, Frydman J. Nature. 2008 Aug 28. 454(7208):1088-95. 10.1038/nature07195 PubMed 18756251