Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pQFT-mNG-Pcon-Scar
(Plasmid #203678)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203678 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pQFT
  • Backbone manufacturer
    Andreas Kaczmarczyk
  • Backbone size w/o insert (bp) 7500
  • Total vector size (bp) 8900
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mNeonGreen
  • Alt name
    mNG
  • Species
    Synthetic
  • Insert Size (bp)
    700
  • Promoter PQJ

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer 10572 (TACATATGTCAATGTACCGG)
  • 3′ sequencing primer M13
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mScarlet-I
  • Species
    Synthetic
  • Insert Size (bp)
    700
  • Promoter Phyb18

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer 18048 (AAATCAGCCGATGTATGTGTTCCG)
  • 3′ sequencing primer M13
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQFT-mNG-Pcon-Scar was a gift from Urs Jenal (Addgene plasmid # 203678 ; http://n2t.net/addgene:203678 ; RRID:Addgene_203678)
  • For your References section:

    A Synthetic Cumate-Inducible Promoter for Graded and Homogenous Gene Expression in Pseudomonas aeruginosa. Klotz A, Kaczmarczyk A, Jenal U. Appl Environ Microbiol. 2023 May 18:e0021123. doi: 10.1128/aem.00211-23. 10.1128/aem.00211-23 PubMed 37199671