pQF-mNGsacB
(Plasmid #203673)

• Purpose: pQF with mNeonGreen and sacB under control of PQ5
• Depositing Lab: Urs Jenal
• Publication: Klotz et al Appl Environ Microbiol. 2023 May 18:e0021123. doi: 10.1128/aem.00211-23.

Backbone

• Vector backbone: pQF
• Backbone manufacturer: Andreas Kaczmarczyk
• Backbone size w/o insert (bp): 7500
• Total vector size (bp): 9500
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mNeonGreen
• Alt name: mNG
• Species: Synthetic
• Insert Size (bp): 700
• Promoter: PQ5

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: 10572 (TACATATGTCAATGTACCGG)

Gene/Insert 2

• Gene/Insert name: sacB
• Species: Bacillus subtilis
• Insert Size (bp): 1400
• Mutation: Has synonymous (silent) mutations to remove BsrGI and HpaI restriction sites
• Promoter: PQ5

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 18048 (AAATCAGCCGATGTATGTGTTCCG)
• 3′ sequencing primer: M13

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry