Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

psicheck2-B4GALT3
(Plasmid #203601)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203601 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    psicheck2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6273
  • Total vector size (bp) 6780
  • Modifications to backbone
    The 3'UTR (nt 1800-2330) of B4GALT3 was inserted between XhoI and NotI in psicheck2.
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    beta-1,4-galactosyltransferase 3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    451
  • Mutation
    nt 1800-2330 3'UTR
  • GenBank ID
    NM_001199873.1
  • Entrez Gene
    B4GALT3 (a.k.a. beta4Gal-T3)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gtggagcgcgtgctgaagaac
  • 3′ sequencing primer ccgcgaggtccgaagactc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psicheck2-B4GALT3 was a gift from Hiroyuki Mizuguchi (Addgene plasmid # 203601 ; http://n2t.net/addgene:203601 ; RRID:Addgene_203601)
  • For your References section:

    miR-27b targets MAIP1 to mediate lipid accumulation in cultured human and mouse hepatic cells. Sakai E, Imaizumi T, Suzuki R, Taracena-Gandara M, Fujimoto T, Sakurai F, Mizuguchi H. Commun Biol. 2023 Jun 24;6(1):669. doi: 10.1038/s42003-023-05049-w. 10.1038/s42003-023-05049-w PubMed 37355744