CSII-TK-MAIP1
(Plasmid #203599)

• Purpose: Lentiviral vector to express MAIP1 in mammalian cells
• Depositing Lab: Hiroyuki Mizuguchi
• Publication: Sakai et al Commun Biol. 2023 Jun 24;6(1):669. doi: 10.1038/s42003-023-05049-w.

Backbone

• Vector backbone: CSII-TK-MCS
• Backbone size w/o insert (bp): 5339
• Modifications to backbone: 9000
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: matrix AAA peptidase interacting protein 1
• Species: H. sapiens (human)
• Insert Size (bp): 774
• Mutation: WT
• GenBank ID: NM_001369399.1
• Entrez Gene: MAIP1 (a.k.a. C2orf47)
• Promoter: TK

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: CGGGTCATAAAAATGGCGCTGG
• 3′ sequencing primer: AAGTCCATAAGCTGATTTTTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry