CSII-TK-B4GALT3
(Plasmid
#203598)
-
PurposeLentiviral vector to express B4GALT3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203598 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCSII-TK-MCS
- Backbone size w/o insert (bp) 5339
- Total vector size (bp) 9610
-
Modifications to backboneORF of B4GLAT3 was cloned between NotI and XbaI in CSII-TK-MCS
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebeta-1,4-galactosyltransferase 3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1384
-
MutationWT
-
GenBank IDNM_001199873.1
-
Entrez GeneB4GALT3 (a.k.a. beta4Gal-T3)
- Promoter TK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GCCGCCGGTTTCATGATTAAGGTAGAC
- 3′ sequencing primer GTGCTGGATGGAGCCTTTCTCTGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CSII-TK-B4GALT3 was a gift from Hiroyuki Mizuguchi (Addgene plasmid # 203598 ; http://n2t.net/addgene:203598 ; RRID:Addgene_203598) -
For your References section:
miR-27b targets MAIP1 to mediate lipid accumulation in cultured human and mouse hepatic cells. Sakai E, Imaizumi T, Suzuki R, Taracena-Gandara M, Fujimoto T, Sakurai F, Mizuguchi H. Commun Biol. 2023 Jun 24;6(1):669. doi: 10.1038/s42003-023-05049-w. 10.1038/s42003-023-05049-w PubMed 37355744