pAG426GAL-CV-B3_3C
(Plasmid
#203499)
-
PurposeExpresses CV-B3 3C protease from a GAL promoter with a URA3 marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203499 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAG426GAL-ccdB
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCV-B3 3C protease
-
Alt nameCoxsackievirus-B3 3C protease
-
Entrez GeneD1P32_gp1 (a.k.a. D1P32_gp1)
- Promoter GAL1
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAATGTAATAAAAGTATCAACAAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG426GAL-CV-B3_3C was a gift from Alejandro Chavez (Addgene plasmid # 203499 ; http://n2t.net/addgene:203499 ; RRID:Addgene_203499)