pLenti-jAspSnFR3-mRuby3-NLS
(Plasmid
#203494)
-
PurposeNuclear directed jAspSnFR3-mRuby3 in lentiviral expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203494 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namejAspSnFR3-mRuby3-NLS
-
Alt name2364
- Promoter CMV
-
Tags
/ Fusion Proteins
- mRuby3 (C terminal on insert)
- Nuclear localization signal (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer agctcgtttagtgaaccgtcagatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.27.546775 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-jAspSnFR3-mRuby3-NLS was a gift from Lucas Sullivan (Addgene plasmid # 203494 ; http://n2t.net/addgene:203494 ; RRID:Addgene_203494) -
For your References section:
An engineered biosensor enables dynamic aspartate measurements in living cells. Davidsen K, Marvin JS, Aggarwal A, Brown TA, Sullivan LB. eLife. 2024 Feb 23;12:RP90024. doi: 10.7554/eLife.90024. 10.7554/eLife.90024 PubMed 38393319