-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 20347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepACYC184
- Backbone size (bp) 4245
-
Vector typeMouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepStart-T2
-
Speciescloning vector
-
GenBank IDEU530621
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAAACTGCCAGGCATCAAACTAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pStart-T2 was a gift from Mario Capecchi (Addgene plasmid # 20347 ; http://n2t.net/addgene:20347 ; RRID:Addgene_20347) -
For your References section:
A protocol for constructing gene targeting vectors: generating knockout mice for the cadherin family and beyond. Wu S, Ying G, Wu Q, Capecchi MR. Nat Protoc. 2008 . 3(6):1056-76. 10.1038/nprot.2008.70 PubMed 18546598