pENTR1a-MTS-jAspSnFR3
(Plasmid
#203461)
-
PurposeMitochondrial directed jAspSnFR3 in Gateway cloning entry vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203461 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR1a
-
Vector typeGateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMTS-jAspSnFR3
-
Insert Size (bp)1923
-
Tag
/ Fusion Protein
- Mitochondrial localization signal (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGTTAGTTAGTTACTTAAGCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains an A to G nucleotide mutation in attL1. This mutation is not known to affect plasmid function.
Please visit https://doi.org/10.1101/2023.06.27.546775 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR1a-MTS-jAspSnFR3 was a gift from Lucas Sullivan (Addgene plasmid # 203461 ; http://n2t.net/addgene:203461 ; RRID:Addgene_203461) -
For your References section:
An engineered biosensor enables dynamic aspartate measurements in living cells. Davidsen K, Marvin JS, Aggarwal A, Brown TA, Sullivan LB. eLife. 2024 Feb 23;12:RP90024. doi: 10.7554/eLife.90024. 10.7554/eLife.90024 PubMed 38393319