pAAV-rBrokenheart
(Plasmid
#203394)
-
PurposeAAV transfer plasmid containing a constitutive (non Cre-dependent) BrokenHeart construct: a piggyBac donor transposon interrupting tdTomato. Transposase activity rescues coding sequence.
-
Depositing Labs
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneAAV-short_BrokenHeart (no BC)
- Total vector size (bp) 7267
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBrokenheart
-
SpeciesSynthetic
-
Insert Size (bp)1653
- Promoter EF1a
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tcaagcctcagacagtggttc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.07.544098v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-rBrokenheart was a gift from Joseph Dougherty & Rob Mitra (Addgene plasmid # 203394 ; http://n2t.net/addgene:203394 ; RRID:Addgene_203394) -
For your References section:
Calling Cards: A Customizable Platform to Longitudinally Record Protein-DNA Interactions Over Time in Cells and Tissues. Yen A, Mateusiak C, Sarafinovska S, Gachechiladze MA, Guo J, Chen X, Moudgil A, Cammack AJ, Hoisington-Lopez J, Crosby M, Brent MR, Mitra RD, Dougherty JD. Curr Protoc. 2023 Sep;3(9):e883. doi: 10.1002/cpz1.883. 10.1002/cpz1.883 PubMed 37755132
