pAAV-H2B-tdTomato-SRT
(Plasmid #203393)

• Purpose: AAV transfer plasmid containing H2B fused piggyBac self-reporting transposon with tdTomato marker for mammalian calling cards
• Depositing Labs: Joseph Dougherty, Rob Mitra
• Publication: Yen et al Curr Protoc. 2023 Sep;3(9):e883. doi: 10.1002/cpz1.883.

Backbone

• Vector backbone: Unknown
• Total vector size (bp): 6971
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H2B fused piggyBac tdTomato self-reporting transposon
• Species: Synthetic
• Insert Size (bp): 3812
• Promoter: Ef1a
• Tags / Fusion Proteins:
  • H2B (N terminal on insert)
  • 3X SV40 (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: tcaagcctcagacagtggttc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.06.07.544098v1 for bioRxiv preprint.