pML31
(Plasmid #203343)

• Purpose: 3 input AND circuit on pLW555 backbone: PTet-P1, PLux-A1, PIcaRA:PPhlF:PAmtR-Q2, PTac-I1
• Depositing Lab: Lauren Andrews
• Publication: Lebovich et al ACS Synth Biol. 2023 Aug 15. doi: 10.1021/acssynbio.3c00232.

Backbone

• Vector backbone: pLW555
• Backbone size w/o insert (bp): 5600
• Total vector size (bp): 9267

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: phlF
• Insert Size (bp): 603
• Promoter: PTet

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: TGGCTCATAACACCCCTTG

Gene/Insert 2

• Gene/Insert name: amtR
• Insert Size (bp): 669
• Promoter: PLux

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GTTTGTCCGGGTACACAGC

Gene/Insert 3

• Gene/Insert name: qacR
• Insert Size (bp): 567
• Promoter: PPhlF, PIcaRA, and PAmtR

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: CTGGAACTGATTAAACAGGCAGATG

Gene/Insert 4

• Gene/Insert name: icaRA
• Insert Size (bp): 561
• Promoter: PTac

Cloning Information for Gene/Insert 4

• Cloning method: Unknown
• 5′ sequencing primer: TGGCCTGAGCAAATAAGTCAG

Resource Information

• Supplemental Documents:
  • pML31.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry