pWR63
(Plasmid #203331)

• Purpose: episomal Cas9 and sgRNA expression vector without sgRNA for S. stipitis
• Depositing Lab: J. Brian Robertson
• Publication: Reichard et al mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22.

Backbone

• Vector backbone: pWR54
• Backbone manufacturer: Robertson
• Backbone size w/o insert (bp): 8299
• Total vector size (bp): 12119
• Modifications to backbone: CaCas9 from pV1093 (Vyas, Barrasa, Fink, 2015, Science advances. 1:e1500248) was added to pWR54 in place of coCBG. An sgRNA expression cassette was added that contained TDH3 promoter driving tRNA-sgRNA(SapI)-HDV element terminated by ADH1 terminator.
• Vector type: Yeast Expression, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: TEF1 promoter (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 726
• Entrez Gene: TEF1 (a.k.a. PICST_65303)

Gene/Insert 2

• Gene/Insert name: coHPH
• Species: Synthetic
• Insert Size (bp): 1029

Gene/Insert 3

• Gene/Insert name: ACT1 terminator (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 400

Gene/Insert 4

• Gene/Insert name: CCW12 promoter (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 749

Gene/Insert 5

• Gene/Insert name: CaCas9
• Species: Synthetic
• Insert Size (bp): 1629

Cloning Information for Gene/Insert 5

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: AflII (not destroyed)
• 5′ sequencing primer: AACTGTCTGCCTTTGAGG
• 3′ sequencing primer: GTCGTAATCAACATCCATATTC

Gene/Insert 6

• Gene/Insert name: ADH2 terminator (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 374

Gene/Insert 7

• Gene/Insert name: ARS from S. stipitis chromosome 1
• Species: S. stipitis (yeast)
• Insert Size (bp): 1148

Gene/Insert 8

• Gene/Insert name: THD3 promoter (S. stipitis)
• Species: S. stipitis
• Insert Size (bp): 750

Cloning Information for Gene/Insert 8

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (not destroyed)
• 3′ cloning site: FseI (not destroyed)
• 5′ sequencing primer: TTCATTTACACAAGCTAGAACC

Gene/Insert 9

• Gene/Insert name: tRNA-sgRNA(SapI)-HDV
• Species: Synthetic
• Insert Size (bp): 242

Cloning Information for Gene/Insert 9

• Cloning method: Restriction Enzyme
• 5′ cloning site: FseI (destroyed during cloning)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: ctgcagccaatctgaaga
• 3′ sequencing primer: CAGAGAAGAATGCATGCAC

Gene/Insert 10

• Gene/Insert name: ADH1 terminator (S. stipitis)
• Species: S. stipitis
• Insert Size (bp): 241

Cloning Information for Gene/Insert 10

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: ctgcagccaatctgaaga
• 3′ sequencing primer: CAGAGAAGAATGCATGCAC

Resource Information

• Supplemental Documents:
  • WR63.gb
• A portion of this plasmid was derived from a plasmid made by: CaCas9 that is in this plasmid was originally synthesized, cloned and published by Vyas VK, Barrasa MI, Fink GR. 2015. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science advances. 1:e1500248.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry