pSLQ9713: pHR-PGK-SV40_NLS-dCasMINI-V4-QNZF-c-Myc_NLS-mCherry-WPRE
(Plasmid
#203219)
-
PurposeExpression of dCasMINI-V4-QNZF-mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203219 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCasMINI-V4-QNZF-mCherry
- Promoter PGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAAAAGCGCACGTCTGCCGC
- 3′ sequencing primer GATACAAAGGCATTAAAGCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ9713: pHR-PGK-SV40_NLS-dCasMINI-V4-QNZF-c-Myc_NLS-mCherry-WPRE was a gift from Stanley Qi (Addgene plasmid # 203219 ; http://n2t.net/addgene:203219 ; RRID:Addgene_203219) -
For your References section:
Development of compact transcriptional effectors using high-throughput measurements in diverse contexts. Tycko J, Van MV, Aradhana, DelRosso N, Ye H, Yao D, Valbuena R, Vaughan-Jackson A, Xu X, Ludwig C, Spees K, Liu K, Gu M, Khare V, Mukund AX, Suzuki PH, Arana S, Zhang C, Du PP, Ornstein TS, Hess GT, Kamber RA, Qi LS, Khalil AS, Bintu L, Bassik MC. Nat Biotechnol. 2024 Nov 1. doi: 10.1038/s41587-024-02442-6. 10.1038/s41587-024-02442-6 PubMed 39487265