psiCHECK2 RPS28 UTR1 WT
(Plasmid
#203157)
-
PurposeRPS28 UTR luciferase assay plasmid (WT UTR1, sites 1 and 2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepsiCHECK2
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRPS28 UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)207
-
Entrez GeneRPS28 (a.k.a. DBA15, S28, eS28)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer N/A
- 3′ sequencing primer TCCAGAGCCTGTCCACGTAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
207 bp region of the human RPS28 UTR containing two MIR-28 binding sites (WT). Cloned from MCF10A cell line genomic DNA.
Please visit https://pubmed.ncbi.nlm.nih.gov/36824951/ for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK2 RPS28 UTR1 WT was a gift from Susan Baserga (Addgene plasmid # 203157 ; http://n2t.net/addgene:203157 ; RRID:Addgene_203157) -
For your References section:
Discovery of novel microRNA mimic repressors of ribosome biogenesis. Bryant CJ, McCool MA, Rosado Gonzalez GT, Abriola L, Surovtseva YV, Baserga SJ. Nucleic Acids Res. 2024 Feb 28;52(4):1988-2011. doi: 10.1093/nar/gkad1235. 10.1093/nar/gkad1235 PubMed 38197221