pHYX143
(Plasmid
#202816)
-
PurposeControl plasmid expressing mScarlet-I fluorescent protein.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202816 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHYX137
- Backbone size w/o insert (bp) 7779
- Total vector size (bp) 8475
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet-I
-
SpeciesSynthetic
-
Insert Size (bp)696
-
GenBank IDAPD76536.1 KY021424.1
- Promoter ScPCK1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGAAGAAGGAGCTCGCTC
- 3′ sequencing primer GGATCAGCTCGGCCTTGTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHYX143 was a gift from Jean-Félix Dallery (Addgene plasmid # 202816 ; http://n2t.net/addgene:202816 ; RRID:Addgene_202816) -
For your References section:
Yeast-based heterologous production of the colletochlorin family of fungal secondary metabolites. Geistodt-Kiener A, Totozafy JC, Le Goff G, Vergne J, Sakai K, Ouazzani J, Mouille G, Viaud M, O'Connell RJ, Dallery JF. Metab Eng. 2023 Oct 18:S1096-7176(23)00142-8. doi: 10.1016/j.ymben.2023.10.002. 10.1016/j.ymben.2023.10.002 PubMed 37863177