CD-MPR-GFP-RUSH
(Plasmid #202797)

• Purpose: RUSH cargo: Str-KDEL_IRES_SBP-EGFP-CD-MPR
• Depositing Lab: Juan Bonifacino
• Publication: Chen et al J Cell Biol. 2017 Dec 4;216(12):4141-4151. doi: 10.1083/jcb.201707172. Epub 2017 Oct 4.

Backbone

• Vector backbone: Original RUSH construct (gift of F. Perezand G. Boncompain, Curie Institute; Boncompain et al., 2012, Nature Methods)
• Total vector size (bp): 6721
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: M6PR
• Alt name: CD-MPR
• Species: H. sapiens (human)
• Insert Size (bp): 756
• Mutation: Changed 40 K (AAA) with R (AGA)
• GenBank ID: NM_002355.4
• Entrez Gene: M6PR (a.k.a. CD-M6PR, CD-MPR, MPR 46, MPR-46, MPR46, SMPR)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • mCherry-CDMPR.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry