pWR58
(Plasmid #202795)

• Purpose: integrating bioluminescene reporter for Cas9 activity in S. stipitis
• Depositing Lab: J. Brian Robertson
• Publication: Reichard et al mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22.

Backbone

• Vector backbone: pAllet
• Backbone manufacturer: Robertson
• Backbone size w/o insert (bp): 2216
• Total vector size (bp): 9734
• Modifications to backbone: pWR58 was constructed by first moving the PTEF1-ShBle-TACT1 insert from pWR10 into pAllet, then upstream of this adding an insert that contained a portion of pWR9 that included the TDH3 promoter and the first two thirds of the coCBG CDS plus the 20 nucleotide YUM1 Cas9 target sequence next to a PAM. Similarly downstream of the ShBle insert an insert was added that contained the 20 nucleotide YUM1 Cas9 target sequence next to a PAM followed by a portion of pWR9 that included the last two thirds of the coCBG CDS and ADH2 terminator. Finally, the URA3 integration element from pWR9 was excised and transferred to the plasmid.
• Vector type: Yeast Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: P-TDH3/coCBG(first portion)-YUM1
• Species: Synthetic; S. stipitis (yeast)
• Insert Size (bp): 1854

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TCGTTAGTATTTCCGTGAAG
• 3′ sequencing primer: CCAAATCAGTGAACCTTGTC

Gene/Insert 2

• Gene/Insert name: P-TEF1/ShBle/T-ACT1
• Species: Synthetic; S. stipitis (yeast)
• Insert Size (bp): 1513

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XbaI (destroyed during cloning)
• 5′ sequencing primer: ATCTACCAGCGCTAACATTC
• 3′ sequencing primer: TCTGCATGACTCCCTTTG

Gene/Insert 3

• Gene/Insert name: YUM1-coCBG(last portion)/T-ADH2
• Species: Synthetic; S. stipitis (yeast)
• Insert Size (bp): 1467

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GGTGAAGTGTATAGAATTGTGC

Gene/Insert 4

• Gene/Insert name: URA3 and flanking sequence
• Species: S. stipitis (yeast)
• Insert Size (bp): 2754

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: CTCAGTACGAACAAGAGAATGA
• 3′ sequencing primer: CACAGGGTTGATATTGTACG

Resource Information

• Supplemental Documents:
  • WR58.gb
• A portion of this plasmid was derived from a plasmid made by: coCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry