pWR76
(Plasmid #202776)

• Purpose: episomal fluorescent reporter plasmid for S. stipitis
• Depositing Lab: J. Brian Robertson
• Publication: Reichard et al mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22.

Backbone

• Vector backbone: pWR9
• Backbone manufacturer: Robertson
• Total vector size (bp): 7237
• Modifications to backbone: coCBG bioluminescence cds in pWR9 was replaced with coCherry red fluorescence cds
• Vector type: Yeast Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: TEF1 promoter (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 726
• Entrez Gene: TEF1 (a.k.a. PICST_65303)

Gene/Insert 2

• Gene/Insert name: coHPH
• Species: Synthetic
• Insert Size (bp): 1029

Gene/Insert 3

• Gene/Insert name: ACT1 terminator (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 400

Gene/Insert 4

• Gene/Insert name: TDH3 promoter (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 749

Gene/Insert 5

• Gene/Insert name: coCherry
• Alt name: yEmRFP
• Insert Size (bp): 711

Cloning Information for Gene/Insert 5

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: AflII (not destroyed)
• 5′ sequencing primer: TTCACATTTCGAAATCCTG
• 3′ sequencing primer: GCATTCAGAGTCTACACTTC

Gene/Insert 6

• Gene/Insert name: ADH2 terminator (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 374

Gene/Insert 7

• Gene/Insert name: ARS from S. stipitis chromosome 1
• Species: S. stipitis (yeast)
• Insert Size (bp): 1148

Resource Information

• Supplemental Documents:
  • WR76.gb
• A portion of this plasmid was derived from a plasmid made by: coCherry that is in pWR76 (also called yEmRFP) was provided by Neta Dean (Stony Brook U) published in Keppler-Ross, S., Noffz, C., Dean, N. (2008). A new purple fluorescent color marker for genetic studies in Saccharomyces cerevisiae and Candida albicans. Genetics, 179(1), 705–710.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry