Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pWR24
(Plasmid #202771)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202771 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pWR9
  • Total vector size (bp) 7702
  • Modifications to backbone
    coHPH hygromycin resistance cds of pWR9 was replaced with coNAT norseothricin resistance cds
  • Vector type
    Yeast Expression
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    TEF1 promoter (S. stipitis)
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    726
  • Entrez Gene
    TEF1 (a.k.a. PICST_65303)

Gene/Insert 2

  • Gene/Insert name
    coNAT
  • Species
    Synthetic
  • Insert Size (bp)
    1029

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACCAGTTCCTCCCATTGTAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    ACT1 terminator (S. stipitis)
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    400

Gene/Insert 4

  • Gene/Insert name
    TDH3 promoter (S. stipitis)
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    749

Gene/Insert 5

  • Gene/Insert name
    coCBG
  • Species
    Synthetic
  • Insert Size (bp)
    1629

Gene/Insert 6

  • Gene/Insert name
    ADH2 terminator (S. stipitis)
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    374

Gene/Insert 7

  • Gene/Insert name
    ARS from S. stipitis chromosome 1
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    1148

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    coCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Selection of this plasmid (pWR24) in S. stipitis on nourseothricin was not successful with our attempts.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWR24 was a gift from J. Brian Robertson (Addgene plasmid # 202771 ; http://n2t.net/addgene:202771 ; RRID:Addgene_202771)
  • For your References section:

    BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937