P931_CLYBL-CBX3-Cbh-Zeo-TetO-NAIP2
(Plasmid #202761)

• Purpose: Encodes four RGC specific transcription factors under the control of a TetOn promoter at the CLYBL safe harbor
• Depositing Lab: Karl Wahlin
• Publication: Agarwal et al NPJ Regen Med. 2023 Sep 29;8(1):55. doi: 10.1038/s41536-023-00327-x.

Backbone

• Vector backbone: pUC19
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NEUROG2-p2A-ATOH7-p2A-ISL1-p2A-POU4F2
• Alt name: NAIP2
• Species: H. sapiens (human)
• Insert Size (bp): 3747
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Entrez Gene: ATOH7 (a.k.a. Math5, NCRNA, PHPVAR, RNANC, bHLHa13)
• Entrez Gene: ISL1 (a.k.a. ISLET1, Isl-1)
• Entrez Gene: POU4F2 (a.k.a. BRN3.2, BRN3B, Brn-3b)
• Promoter: TetO

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTCGTTTAGTGAACCGTCAG

Resource Information

• Supplemental Documents:
  • P931_CLYBL-CBX3-Cbh-Zeo-TetO-NAIP2

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry