P789_pY026_EnAsCpf1_CLYBL_T1_catRNA
(Plasmid
#202760)
-
PurposeEncodes for CRISPR-Cas12a (EnAsCpf1) with gRNA for targeting the CLYBL safe harbor site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 4963
- Total vector size (bp) 9767
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuAsCpf1
-
gRNA/shRNA sequenceACTTCCTTACTGTTAACTTCCATA
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byZhang Lab (Addgene Plasmid #84741)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P789_pY026_EnAsCpf1_CLYBL_T1_catRNA was a gift from Karl Wahlin (Addgene plasmid # 202760 ; http://n2t.net/addgene:202760 ; RRID:Addgene_202760) -
For your References section:
Human retinal ganglion cell neurons generated by synchronous BMP inhibition and transcription factor mediated reprogramming. Agarwal D, Dash N, Mazo KW, Chopra M, Avila MP, Patel A, Wong RM, Jia C, Do H, Cheng J, Chiang C, Jurlina SL, Roshan M, Perry MW, Rho JM, Broyer R, Lee CD, Weinreb RN, Gavrilovici C, Oesch NW, Welsbie DS, Wahlin KJ. NPJ Regen Med. 2023 Sep 29;8(1):55. doi: 10.1038/s41536-023-00327-x. 10.1038/s41536-023-00327-x PubMed 37773257