Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

P789_pY026_EnAsCpf1_CLYBL_T1_catRNA
(Plasmid #202760)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202760 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 4963
  • Total vector size (bp) 9767
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    huAsCpf1
  • gRNA/shRNA sequence
    ACTTCCTTACTGTTAACTTCCATA
  • Species
    Synthetic
  • Promoter CMV

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P789_pY026_EnAsCpf1_CLYBL_T1_catRNA was a gift from Karl Wahlin (Addgene plasmid # 202760 ; http://n2t.net/addgene:202760 ; RRID:Addgene_202760)
  • For your References section:

    Human retinal ganglion cell neurons generated by synchronous BMP inhibition and transcription factor mediated reprogramming. Agarwal D, Dash N, Mazo KW, Chopra M, Avila MP, Patel A, Wong RM, Jia C, Do H, Cheng J, Chiang C, Jurlina SL, Roshan M, Perry MW, Rho JM, Broyer R, Lee CD, Weinreb RN, Gavrilovici C, Oesch NW, Welsbie DS, Wahlin KJ. NPJ Regen Med. 2023 Sep 29;8(1):55. doi: 10.1038/s41536-023-00327-x. 10.1038/s41536-023-00327-x PubMed 37773257