pLenti-CMV-Myr-Pink Flamindo-p2a-EGFP-bPAC
(Plasmid #202717)

• Purpose: Mammalian co-expression of membrane-bound Pink Flamindo and soluble bPAC for cAMP perturbation and imaging
• Depositing Lab: Adam Cohen
• Publication: Xiang et al bioRxiv 2023

Backbone

• Vector backbone: pLenti
• Backbone size w/o insert (bp): 8538
• Total vector size (bp): 11679
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Myr-Pink Flamindo
• Species: Synthetic
• Insert Size (bp): 1221
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: agaagacaccgactctagaggatc
• 3′ sequencing primer: aagttcgtggctccggagcCCTTGTACAGCTCGTCCATGC

Gene/Insert 2

• Gene/Insert name: EGFP-bPAC
• Species: Synthetic; Beggiatoa sp
• Insert Size (bp): 1854
• Tags / Fusion Proteins:
  • myc (C terminal on insert)
  • 10xHis (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gctgtacaagGGTGGTTCTGGTATGAAG
• 3′ sequencing primer: tatcgataagcttgatatcgaattcTTACTCGAGATGGTGATGGTG

Resource Information

• Supplemental Documents:
  • PP015_pLenti_CMV_Myr-Pink Flamindo-P2A-EGFP-bPAC.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry