Skip to main content
Addgene

pLenti-CMV-Pink Flamindo-p2a-bPAC
(Plasmid #202716)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202716 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 8538
  • Total vector size (bp) 10905
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Pink Flamindo
  • Species
    Synthetic
  • Insert Size (bp)
    1173
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agaagacaccgactctagaggatc
  • 3′ sequencing primer aagttcgtggctccggagcCCTTGTACAGCTCGTCCATGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    bPAC
  • Species
    Synthetic; Beggiatoa sp.
  • Insert Size (bp)
    1128
  • Tags / Fusion Proteins
    • myc (C terminal on insert)
    • 10xHis (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tggaagaaaaccccggtcccATGAAGCGGCTGGTGTAC
  • 3′ sequencing primer tatcgataagcttgatatcgaattcTTACTCGAGATGGTGATGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CMV-Pink Flamindo-p2a-bPAC was a gift from Adam Cohen (Addgene plasmid # 202716 ; http://n2t.net/addgene:202716 ; RRID:Addgene_202716)
  • For your References section:

    All-optical mapping of cAMP transport reveals rules of sub-cellular localization. Xiang KM, Park P, Koren SA, Hayward RF, Cohen AE. bioRxiv 2023 10.1101/2023.06.27.546633