Skip to main content
Addgene

pWR9
(Plasmid #202645)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202645 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAllet
  • Backbone manufacturer
    Robertson
  • Backbone size w/o insert (bp) 2216
  • Total vector size (bp) 8155
  • Modifications to backbone
    S. stipitis promoter (TEF1) driving coHPH with S. stipitis terminator (ACT1), S. stipitis promoter (TDH3) driving coCBG with S. stipitis terminator (ADH2), S. stipitis ARS
  • Vector type
    Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    TEF1 promoter (S. stipitis)
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    726
  • Entrez Gene
    TEF1 (a.k.a. PICST_65303)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer CCGTACACTTATTGTTAACTATGAA
  • 3′ sequencing primer TGTAGATAGACTTAGATTGTATGAAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    coHPH
  • Species
    Synthetic
  • Insert Size (bp)
    1029

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACCAGTTCCTCCCATTGTAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    ACT1 terminator (S. stipitis)
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    400

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer AACCACTTGCAAAATCCTTTG
  • 3′ sequencing primer GAACTTGATTGTAATACAAAATGC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    TDH3 promoter (S. stipitis)
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    749

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TCGTTAGTATTTCCGTGAAG
  • 3′ sequencing primer GATGAATTGTTTATAGGGAAGA
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    coCBG
  • Species
    Synthetic
  • Insert Size (bp)
    1629

Cloning Information for Gene/Insert 5

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site AflII (not destroyed)
  • 5′ sequencing primer TGTTTCTTCAGAATCAATTCAC
  • (Common Sequencing Primers)

Gene/Insert 6

  • Gene/Insert name
    ADH2 terminator (S. stipitis)
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    374

Cloning Information for Gene/Insert 6

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CATTTTAGACAAGTGCCTATT
  • 3′ sequencing primer TTCTGCCTTCTGAACGTTTG
  • (Common Sequencing Primers)

Gene/Insert 7

  • Gene/Insert name
    ARS from S. stipitis chromosome 1
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    1148

Cloning Information for Gene/Insert 7

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer AGTATAGGATATGGTGATTTAGC
  • 3′ sequencing primer CTGCGGTGTCTACAAGGTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    coCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWR9 was a gift from J. Brian Robertson (Addgene plasmid # 202645 ; http://n2t.net/addgene:202645 ; RRID:Addgene_202645)
  • For your References section:

    BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937