pWR9
(Plasmid #202645)

• Purpose: episomal bioluminescent reporter plasmid for S. stipitis
• Depositing Lab: J. Brian Robertson
• Publication: Reichard et al mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22.

Backbone

• Vector backbone: pAllet
• Backbone manufacturer: Robertson
• Backbone size w/o insert (bp): 2216
• Total vector size (bp): 8155
• Modifications to backbone: S. stipitis promoter (TEF1) driving coHPH with S. stipitis terminator (ACT1), S. stipitis promoter (TDH3) driving coCBG with S. stipitis terminator (ADH2), S. stipitis ARS
• Vector type: Yeast Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: TEF1 promoter (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 726
• Entrez Gene: TEF1 (a.k.a. PICST_65303)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: CCGTACACTTATTGTTAACTATGAA
• 3′ sequencing primer: TGTAGATAGACTTAGATTGTATGAAA

Gene/Insert 2

• Gene/Insert name: coHPH
• Species: Synthetic
• Insert Size (bp): 1029

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ACCAGTTCCTCCCATTGTAG

Gene/Insert 3

• Gene/Insert name: ACT1 terminator (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 400

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: AACCACTTGCAAAATCCTTTG
• 3′ sequencing primer: GAACTTGATTGTAATACAAAATGC

Gene/Insert 4

• Gene/Insert name: TDH3 promoter (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 749

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: TCGTTAGTATTTCCGTGAAG
• 3′ sequencing primer: GATGAATTGTTTATAGGGAAGA

Gene/Insert 5

• Gene/Insert name: coCBG
• Species: Synthetic
• Insert Size (bp): 1629

Cloning Information for Gene/Insert 5

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: AflII (not destroyed)
• 5′ sequencing primer: TGTTTCTTCAGAATCAATTCAC

Gene/Insert 6

• Gene/Insert name: ADH2 terminator (S. stipitis)
• Species: S. stipitis (yeast)
• Insert Size (bp): 374

Cloning Information for Gene/Insert 6

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CATTTTAGACAAGTGCCTATT
• 3′ sequencing primer: TTCTGCCTTCTGAACGTTTG

Gene/Insert 7

• Gene/Insert name: ARS from S. stipitis chromosome 1
• Species: S. stipitis (yeast)
• Insert Size (bp): 1148

Cloning Information for Gene/Insert 7

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: AGTATAGGATATGGTGATTTAGC
• 3′ sequencing primer: CTGCGGTGTCTACAAGGTC

Resource Information

• Supplemental Documents:
  • WR9.gb
• A portion of this plasmid was derived from a plasmid made by: coCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry