pSB-CMV-MCS-Puro GEM-LTB4
(Plasmid
#202641)
-
PurposeExpresses the LTB4 sensor GEM-LTB4 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202641 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB-CMV-MCS-puro
- Total vector size (bp) 7696
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGEM-LTB4
-
Insert Size (bp)1899
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB-CMV-MCS-Puro GEM-LTB4 was a gift from Balázs Enyedi (Addgene plasmid # 202641 ; http://n2t.net/addgene:202641 ; RRID:Addgene_202641) -
For your References section:
A genetically encoded sensor for visualizing leukotriene B4 gradients in vivo. Tamas SX, Roux BT, Vamosi B, Dehne FG, Torok A, Fazekas L, Enyedi B. Nat Commun. 2023 Aug 1;14(1):4610. doi: 10.1038/s41467-023-40326-6. 10.1038/s41467-023-40326-6 PubMed 37528073