pCAGGS-C-TEV-HAT
(Plasmid
#202597)
-
Purpose(Empty Backbone) Express N-terminal Tobacco Etch Virus (TEV) protease cleavable Histidine Affinity Tag (HAT) (KDHLIHNVHKEEHAHAHNK) in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202597 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGS-C-TEV-Twin-Strep
-
Backbone manufacturerChiaki Murakami
- Backbone size (bp) 4849
-
Modifications to backboneKozak sequence (GCCACC), start codon (ATG), polyhistidine affinity tag (HAT), and TEV were subcloned into the XhoI/BglII site of pCAGGS vector.
-
Vector typeMammalian Expression
- Promoter CAG
-
Tags
/ Fusion Proteins
- TEV cleavable site (ENLYFQG) (C terminal on backbone)
- poly-histidine affinity tag (HAT-tag) (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TATTAGCCAGAAGTCAGATGCTCAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert can be subcloned into Bgl lI site via Gibson Assembly.
HAT-tagged proteins can be purified via Immobilized metal-affinity chromatography
(IMAC). 150 mM imidazole was used to elute the HAT-tagged proteins.
Reference:
1. Applied Microbiology and Biotechnology, volume 60, pages523–533 (2003)
2. Journal of Chromatography A, volume 864, Pages 247-256 (1999)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-C-TEV-HAT was a gift from Chiaki Murakami (Addgene plasmid # 202597 ; http://n2t.net/addgene:202597 ; RRID:Addgene_202597) -
For your References section:
Diacylglycerol kinase zeta interacts with sphingomyelin synthase 1 and sphingomyelin synthase-related protein via different regions. Furuta M, Murakami C, Numagami Y, Suzuki R, Sakane F. FEBS Open Bio. 2023 May 11. doi: 10.1002/2211-5463.13628. 10.1002/2211-5463.13628 PubMed 37166445