mNeonGreen-APEX3
(Plasmid #202590)

• Purpose: Gamma-retroviral vector that expresses mNeonGreen fused to APEX3.
• Depositing Lab: Reuben Harris
• Publication: Becker et al J Mol Biol. 2023 May 12:168145. doi: 10.1016/j.jmb.2023.168145.

Backbone

• Vector backbone: MIGR1-derivative
• Backbone size w/o insert (bp): 6142
• Total vector size (bp): 7647
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mNeonGreen-APEX3-V5
• Alt name: APEX2-L242A
• Insert Size (bp): 1566
• Mutation: APEX2 L242A
• GenBank ID: NM_001250856.1 KC295282.1
• Entrez Gene: APX1 (a.k.a. GLYMA_11G150243v4)
• Promoter: MESV LTR
• Tags / Fusion Proteins:
  • mNeonGreen (N terminal on insert)
  • V5 epitope (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: gggagaggggcgctagtcagtta

Resource Information

• Supplemental Documents:
  • JB836 mNG-APEX3-V5_Blast(L242A).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry