Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAGGS-SMS1-TEV-HAT
(Plasmid #202557)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 202557 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAGGS-N-TEV-HAT
  • Backbone manufacturer
    Chiaki Murakami
  • Backbone size w/o insert (bp) 4833
  • Total vector size (bp) 6083
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SGMS1
  • Alt name
    SMS1
  • Alt name
    Sphingomyelin synthase 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1239
  • Mutation
    deleted stop codon (TAA)
  • GenBank ID
    NM_147156.4 NM_147156.3
  • Entrez Gene
    SGMS1 (a.k.a. MOB, MOB1, SMS1, TMEM23, hmob33)
  • Promoter CAG
  • Tags / Fusion Proteins
    • Histidine-Affinity-tag (HAT) (C terminal on backbone)
    • TEV cleavable site (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer TATTAGCCAGAAGTCAGATGCTCAAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

D332A mutation in SMS1 is critical for SMS enzyme activity (this mutant is SMS1 inactive mutant).

A 19-mer polyhistidine affinity tag (HAT) [KDHLIHNVHKEEHAHAHNK] has a high affinity for cobalt ions, and can be eluted under conditions that are milder than those for the His6 tag. (PMID: 15308696).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-SMS1-TEV-HAT was a gift from Chiaki Murakami (Addgene plasmid # 202557 ; http://n2t.net/addgene:202557 ; RRID:Addgene_202557)
  • For your References section:

    Diacylglycerol kinase zeta interacts with sphingomyelin synthase 1 and sphingomyelin synthase-related protein via different regions. Furuta M, Murakami C, Numagami Y, Suzuki R, Sakane F. FEBS Open Bio. 2023 May 11. doi: 10.1002/2211-5463.13628. 10.1002/2211-5463.13628 PubMed 37166445