pCAGGS-SMS1-TEV-HAT
(Plasmid
#202557)
-
PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable HAT-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202557 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS-N-TEV-HAT
-
Backbone manufacturerChiaki Murakami
- Backbone size w/o insert (bp) 4833
- Total vector size (bp) 6083
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSGMS1
-
Alt nameSMS1
-
Alt nameSphingomyelin synthase 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1239
-
Mutationdeleted stop codon (TAA)
-
GenBank IDNM_147156.4 NM_147156.3
-
Entrez GeneSGMS1 (a.k.a. MOB, MOB1, SMS1, TMEM23, hmob33)
- Promoter CAG
-
Tags
/ Fusion Proteins
- Histidine-Affinity-tag (HAT) (C terminal on backbone)
- TEV cleavable site (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TATTAGCCAGAAGTCAGATGCTCAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
D332A mutation in SMS1 is critical for SMS enzyme activity (this mutant is SMS1 inactive mutant).
A 19-mer polyhistidine affinity tag (HAT) [KDHLIHNVHKEEHAHAHNK] has a high affinity for cobalt ions, and can be eluted under conditions that are milder than those for the His6 tag. (PMID: 15308696).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-SMS1-TEV-HAT was a gift from Chiaki Murakami (Addgene plasmid # 202557 ; http://n2t.net/addgene:202557 ; RRID:Addgene_202557) -
For your References section:
Diacylglycerol kinase zeta interacts with sphingomyelin synthase 1 and sphingomyelin synthase-related protein via different regions. Furuta M, Murakami C, Numagami Y, Suzuki R, Sakane F. FEBS Open Bio. 2023 May 11. doi: 10.1002/2211-5463.13628. 10.1002/2211-5463.13628 PubMed 37166445