pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
(Plasmid
#202555)
-
PurposeSynaptotagmin-1 sgRNA2 with TagBFP2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV-hUV6-sgRNA-dCas9-KRAB-TagBFP
-
Backbone manufacturerDr Konstantin Kogan
- Backbone size w/o insert (bp) 14900
- Total vector size (bp) 15002
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG)
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)76
-
GenBank ID25716
-
Entrez GeneSyt1 (a.k.a. P65)
-
Tag
/ Fusion Protein
- 3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr Konstantin Kogan from DNA Dream Lab (DDL) facility (HiLIFE, Institute of Biotechnology, Helsinki, Finland).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246) was a gift from Frederic Meunier (Addgene plasmid # 202555 ; http://n2t.net/addgene:202555 ; RRID:Addgene_202555) -
For your References section:
Presynaptic targeting of botulinum neurotoxin type A requires a tripartite PSG-Syt1-SV2 plasma membrane nanocluster for synaptic vesicle entry. Joensuu M, Syed P, Saber SH, Lanoue V, Wallis TP, Rae J, Blum A, Gormal RS, Small C, Sanders S, Jiang A, Mahrhold S, Krez N, Cousin MA, Cooper-White R, Cooper-White JJ, Collins BM, Parton RG, Balistreri G, Rummel A, Meunier FA. EMBO J. 2023 Jul 3;42(13):e112095. doi: 10.15252/embj.2022112095. Epub 2023 May 25. 10.15252/embj.2022112095 PubMed 37226896