pCAGGS-C-TEV-Twin-Strep
(Plasmid #202527)

• Purpose: (Empty Backbone) Express N-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged protein (ENLYFQGS-WSHPQFEK-(GGGS)2-GGSA-WSHPQFEK) in mammalian cell
• Depositing Lab: Chiaki Murakami
• Publication: Furuta et al FEBS Open Bio. 2023 May 11. doi: 10.1002/2211-5463.13628.

Backbone

• Vector backbone: pCAGGS
• Backbone manufacturer: Chiaki Murakami
• Backbone size (bp): 4878
• Modifications to backbone: Kozak sequence (GCCACC), start codon (ATG),Twin-Strep-tag, and TEV were subcloned into the XhoI/BglII site of pCAGGS vector.
• Vector type: Mammalian Expression
• Promoter: CAG
• Tags / Fusion Proteins:
  • Twin-Strep-tag (N terminal on backbone)
  • TEV cleavable site (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGACC
• 3′ sequencing primer: TATTAGCCAGAAGTCAGATGCTCAAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The insert can be subcloned into BglII site via Gibson Assembly.

The original plasmid is created by Niwa et al. (Niwa, H., Yamamura, K., Miyazaki, J., Gene 108 : 193-200, 1991).
I'm in the process of creating a protocol for cloning using this plasmid.