pCAGGS-C-TEV-Twin-Strep
(Plasmid
#202527)
-
Purpose(Empty Backbone) Express N-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged protein (ENLYFQGS-WSHPQFEK-(GGGS)2-GGSA-WSHPQFEK) in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202527 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerChiaki Murakami
- Backbone size (bp) 4878
-
Modifications to backboneKozak sequence (GCCACC), start codon (ATG),Twin-Strep-tag, and TEV were subcloned into the XhoI/BglII site of pCAGGS vector.
-
Vector typeMammalian Expression
- Promoter CAG
-
Tags
/ Fusion Proteins
- Twin-Strep-tag (N terminal on backbone)
- TEV cleavable site (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TATTAGCCAGAAGTCAGATGCTCAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert can be subcloned into BglII site via Gibson Assembly.
The original plasmid is created by Niwa et al. (Niwa, H., Yamamura, K., Miyazaki, J., Gene 108 : 193-200, 1991).
I'm in the process of creating a protocol for cloning using this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-C-TEV-Twin-Strep was a gift from Chiaki Murakami (Addgene plasmid # 202527 ; http://n2t.net/addgene:202527 ; RRID:Addgene_202527) -
For your References section:
Diacylglycerol kinase zeta interacts with sphingomyelin synthase 1 and sphingomyelin synthase-related protein via different regions. Furuta M, Murakami C, Numagami Y, Suzuki R, Sakane F. FEBS Open Bio. 2023 May 11. doi: 10.1002/2211-5463.13628. 10.1002/2211-5463.13628 PubMed 37166445