Skip to main content
Addgene

pETM6-T7-VHH72
(Plasmid #202487)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202487 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pETM6
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    nanobody VHH72
  • Species
    Lama glama
  • Promoter T7
  • Tag / Fusion Protein
    • 6XHis (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTGTGAGCGGATAACAATTCCC
  • 3′ sequencing primer ACCCCTCAAGACCCGTTTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETM6-T7-VHH72 was a gift from Michael Lynch (Addgene plasmid # 202487 ; http://n2t.net/addgene:202487 ; RRID:Addgene_202487)
  • For your References section:

    Scalable, robust, high-throughput expression & purification of nanobodies enabled by 2-stage dynamic control. Hennigan JN, Menacho-Melgar R, Sarkar P, Golovsky M, Lynch MD. Metab Eng. 2024 Sep;85:116-130. doi: 10.1016/j.ymben.2024.07.012. Epub 2024 Jul 24. 10.1016/j.ymben.2024.07.012 PubMed 39059674