pSMART-HCKan-yibDp-VHH-C9BoNT-A
(Plasmid
#202475)
-
PurposeExpresses the nanobody C9 BoNT-A after phosphate depletion
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSMART
-
Backbone manufacturerLucigen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenanobody C9 BoNT/A
-
SpeciesLama glama
- Promoter yibDp
-
Tag
/ Fusion Protein
- 6X-His (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGTCCAGTTACGCTGGAGTC
- 3′ sequencing primer GGTCAGGTATGATTTAAATGGTCAGT (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSMART-HCKan-yibDp-VHH-C9BoNT-A was a gift from Michael Lynch (Addgene plasmid # 202475 ; http://n2t.net/addgene:202475 ; RRID:Addgene_202475) -
For your References section:
Scalable, robust, high-throughput expression & purification of nanobodies enabled by 2-stage dynamic control. Hennigan JN, Menacho-Melgar R, Sarkar P, Golovsky M, Lynch MD. Metab Eng. 2024 Sep;85:116-130. doi: 10.1016/j.ymben.2024.07.012. Epub 2024 Jul 24. 10.1016/j.ymben.2024.07.012 PubMed 39059674