pXPR_016-sgATF4-1
(Plasmid
#202455)
-
PurposeExpression of a guide RNA targeting ATF4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202455 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXPR_003
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATF4 gRNA
-
gRNA/shRNA sequenceAGATGACCTTCTGACCACGT
-
SpeciesH. sapiens (human)
-
Entrez GeneATF4 (a.k.a. CREB-2, CREB2, TAXREB67, TXREB)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_016-sgATF4-1 was a gift from William Hahn (Addgene plasmid # 202455 ; http://n2t.net/addgene:202455 ; RRID:Addgene_202455) -
For your References section:
A Ubiquitination Cascade Regulating the Integrated Stress Response and Survival in Carcinomas. Cervia LD, Shibue T, Borah AA, Gaeta B, He L, Leung L, Li N, Moyer SM, Shim BH, Dumont N, Gonzalez A, Bick NR, Kazachkova M, Dempster JM, Krill-Burger JM, Piccioni F, Udeshi ND, Olive ME, Carr SA, Root DE, McFarland JM, Vazquez F, Hahn WC. Cancer Discov. 2023 Mar 1;13(3):766-795. doi: 10.1158/2159-8290.CD-22-1230. 10.1158/2159-8290.CD-22-1230 PubMed 36576405