Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXPR_023d-sgCiBIRC6-1
(Plasmid #202447)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 202447 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXPR_023
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BIRC6 gRNA
  • gRNA/shRNA sequence
    GAGCGCAGGCCGGAAGAGTT
  • Species
    H. sapiens (human)
  • Entrez Gene
    BIRC6 (a.k.a. APOLLON, BRUCE)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_023d-sgCiBIRC6-1 was a gift from William Hahn (Addgene plasmid # 202447 ; http://n2t.net/addgene:202447 ; RRID:Addgene_202447)
  • For your References section:

    A Ubiquitination Cascade Regulating the Integrated Stress Response and Survival in Carcinomas. Cervia LD, Shibue T, Borah AA, Gaeta B, He L, Leung L, Li N, Moyer SM, Shim BH, Dumont N, Gonzalez A, Bick NR, Kazachkova M, Dempster JM, Krill-Burger JM, Piccioni F, Udeshi ND, Olive ME, Carr SA, Root DE, McFarland JM, Vazquez F, Hahn WC. Cancer Discov. 2023 Mar 1;13(3):766-795. doi: 10.1158/2159-8290.CD-22-1230. 10.1158/2159-8290.CD-22-1230 PubMed 36576405