Skip to main content
Addgene

pXPR_003-sgBIRC6-4
(Plasmid #202438)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202438 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXPR_003
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BIRC6 gRNA
  • gRNA/shRNA sequence
    GAACAGAGAGTATCCAACACA
  • Species
    H. sapiens (human)
  • Entrez Gene
    BIRC6 (a.k.a. APOLLON, BRUCE)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_003-sgBIRC6-4 was a gift from William Hahn (Addgene plasmid # 202438 ; http://n2t.net/addgene:202438 ; RRID:Addgene_202438)
  • For your References section:

    A Ubiquitination Cascade Regulating the Integrated Stress Response and Survival in Carcinomas. Cervia LD, Shibue T, Borah AA, Gaeta B, He L, Leung L, Li N, Moyer SM, Shim BH, Dumont N, Gonzalez A, Bick NR, Kazachkova M, Dempster JM, Krill-Burger JM, Piccioni F, Udeshi ND, Olive ME, Carr SA, Root DE, McFarland JM, Vazquez F, Hahn WC. Cancer Discov. 2023 Mar 1;13(3):766-795. doi: 10.1158/2159-8290.CD-22-1230. 10.1158/2159-8290.CD-22-1230 PubMed 36576405