pTY137 psfGFP-bimax2
(Plasmid
#202410)
-
PurposeExpresses sfGFP-bimax2 to inhibit importin-alpha-mediated nuclear import
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonesfGFP-C1
- Backbone size w/o insert (bp) 4750
- Total vector size (bp) 4795
-
Modifications to backboneNone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebimax2
-
SpeciesSynthetic
-
Insert Size (bp)78
- Promoter CMV
-
Tag
/ Fusion Protein
- sfGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhOI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
bimax2 protein sequence (RRRRRRKRKREWDDDDDPPKKRRRLD) derived from Kosugi et al, Chemistry and Biology 2008
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTY137 psfGFP-bimax2 was a gift from Tim Mitchison (Addgene plasmid # 202410 ; http://n2t.net/addgene:202410 ; RRID:Addgene_202410) -
For your References section:
O-GlcNAc modification of nuclear pore complexes accelerates bidirectional transport. Yoo TY, Mitchison TJ. J Cell Biol. 2021 Jul 5;220(7). pii: 212033. doi: 10.1083/jcb.202010141. 10.1083/jcb.202010141 PubMed 33909044