Skip to main content
Addgene

pTY137 psfGFP-bimax2
(Plasmid #202410)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202410 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    sfGFP-C1
  • Backbone size w/o insert (bp) 4750
  • Total vector size (bp) 4795
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    bimax2
  • Species
    Synthetic
  • Insert Size (bp)
    78
  • Promoter CMV
  • Tag / Fusion Protein
    • sfGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhOI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

bimax2 protein sequence (RRRRRRKRKREWDDDDDPPKKRRRLD) derived from Kosugi et al, Chemistry and Biology 2008

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTY137 psfGFP-bimax2 was a gift from Tim Mitchison (Addgene plasmid # 202410 ; http://n2t.net/addgene:202410 ; RRID:Addgene_202410)
  • For your References section:

    O-GlcNAc modification of nuclear pore complexes accelerates bidirectional transport. Yoo TY, Mitchison TJ. J Cell Biol. 2021 Jul 5;220(7). pii: 212033. doi: 10.1083/jcb.202010141. 10.1083/jcb.202010141 PubMed 33909044