pLenti-U6-DCK-Hygro
(Plasmid
#202409)
-
PurposegRNA expression vector for DCK
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiGuide-Puro
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 8322
- Total vector size (bp) 8330
-
Vector typeLentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameguide RNA
-
gRNA/shRNA sequenceAAGTACTCAAGATGAATTTG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1000
-
Entrez GeneDCK
- Promoter U6
-
Tag
/ Fusion Protein
- Dck
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBⅠ (unknown if destroyed)
- 3′ cloning site BsmBⅠ (unknown if destroyed)
- 5′ sequencing primer M13 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.07.15.500173v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-U6-DCK-Hygro was a gift from Morito Kurata (Addgene plasmid # 202409 ; http://n2t.net/addgene:202409 ; RRID:Addgene_202409) -
For your References section:
Indirect CRISPR screening with photoconversion revealed key factors of drug resistance with cell-cell interactions. Sugita K, Onishi I, Nakayama R, Ishibashi S, Ikeda M, Inoue M, Narita R, Oshima S, Shimizu K, Saito S, Sato S, Moriarity BS, Yamamoto K, Largaespada DA, Kitagawa M, Kurata M. Commun Biol. 2023 Jun 1;6(1):582. doi: 10.1038/s42003-023-04941-9. 10.1038/s42003-023-04941-9 PubMed 37264057