Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-U6-DCK-Hygro
(Plasmid #202409)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202409 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiGuide-Puro
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 8322
  • Total vector size (bp) 8330
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    guide RNA
  • gRNA/shRNA sequence
    AAGTACTCAAGATGAATTTG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1000
  • Entrez Gene
    DCK
  • Promoter U6
  • Tag / Fusion Protein
    • Dck

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBⅠ (unknown if destroyed)
  • 3′ cloning site BsmBⅠ (unknown if destroyed)
  • 5′ sequencing primer M13
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-U6-DCK-Hygro was a gift from Morito Kurata (Addgene plasmid # 202409 ; http://n2t.net/addgene:202409 ; RRID:Addgene_202409)
  • For your References section:

    Indirect CRISPR screening with photoconversion revealed key factors of drug resistance with cell-cell interactions. Sugita K, Onishi I, Nakayama R, Ishibashi S, Ikeda M, Inoue M, Narita R, Oshima S, Shimizu K, Saito S, Sato S, Moriarity BS, Yamamoto K, Largaespada DA, Kitagawa M, Kurata M. Commun Biol. 2023 Jun 1;6(1):582. doi: 10.1038/s42003-023-04941-9. 10.1038/s42003-023-04941-9 PubMed 37264057