pDendra2-Hygro
(Plasmid
#202407)
-
PurposeDendra2 expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202407 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDendra2-N Vector
-
Backbone manufacturerClontech Laboratories, Inc.
- Backbone size w/o insert (bp) 4705
- Total vector size (bp) 5758
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHygromycin
-
Insert Size (bp)1000
- Promoter CMV
-
Tag
/ Fusion Protein
- Dendra2 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer CACCAAAATCAACGGGACTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.07.15.500173v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDendra2-Hygro was a gift from Morito Kurata (Addgene plasmid # 202407 ; http://n2t.net/addgene:202407 ; RRID:Addgene_202407) -
For your References section:
Indirect CRISPR screening with photoconversion revealed key factors of drug resistance with cell-cell interactions. Sugita K, Onishi I, Nakayama R, Ishibashi S, Ikeda M, Inoue M, Narita R, Oshima S, Shimizu K, Saito S, Sato S, Moriarity BS, Yamamoto K, Largaespada DA, Kitagawa M, Kurata M. Commun Biol. 2023 Jun 1;6(1):582. doi: 10.1038/s42003-023-04941-9. 10.1038/s42003-023-04941-9 PubMed 37264057