pJYP1
(Plasmid #202406)

• Purpose: (Empty Backbone) Backbone vector to clone toxic or unstable DNA using dual-control (transcriptional control via naringenin inducible pfdeA promoter - translational control via B12 riboswitch)
• Depositing Lab: Remy Loris
• Publication: Vandierendonck et al Toxins (Basel). 2023 Aug 18;15(8):508. doi: 10.3390/toxins15080508.

Backbone

• Vector backbone: pET22b
• Modifications to backbone: The pET22b expression vector was modified by inserting the fdeR transcriptional activator and promoter operator region (PfdeA – fdeO) followed by a vitamin B12 riboswitch (RSB12) into the HpaI and XhoI site. The resulting pJYP1 vector contains a BglII restriction site downstream of the riboswitch to allow toxin cloning.
• Vector type: Bacterial Expression
• Promoter: fdeA

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Cloning Information

• 5′ sequencing primer: CATAAGGACAGGAGAGCGTTC
• 3′ sequencing primer: GCGAAAATCCTGTTTGATGGTGG

Resource Information

• Supplemental Documents:
  • pJYP1_genbank_OQ725380.1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry