Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRmHa3-dKDM4A-H195A-HA2FL2
(Plasmid #20235)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20235 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRmHa3-CHA2FL2
  • Backbone size w/o insert (bp) 3990
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dKDM4A
  • Alt name
    CG15835
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1488
  • Mutation
    changed His 195 to Ala
  • GenBank ID
    NM_136487
  • Entrez Gene
    Kdm4A (a.k.a. CG15835, dJMJD2(1), dKDM4A, Dmel\CG15835)
  • Tags / Fusion Proteins
    • HA2 (C terminal on backbone)
    • FLAG2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer agaggtgaatcgaacgaaagacccg
  • 3′ sequencing primer gtagagcgtttatcagttttttgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

D153E mutation is also present, but it does affect the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRmHa3-dKDM4A-H195A-HA2FL2 was a gift from Jerry Workman (Addgene plasmid # 20235 ; http://n2t.net/addgene:20235 ; RRID:Addgene_20235)
  • For your References section:

    Heterochromatin protein 1a stimulates histone H3 lysine 36 demethylation by the Drosophila KDM4A demethylase. Lin CH, Li B, Swanson S, Zhang Y, Florens L, Washburn MP, Abmayr SM, Workman JL. Mol Cell. 2008 Dec 5. 32(5):696-706. 10.1016/j.molcel.2008.11.008 PubMed 19061644